Charismatic Theology Mission in the Spirit

Introduction Theology should reflect a form that God chooses to manifest Him to humanity in the contemporary society. In that way, humanity is faced with the challenge whether there has to be Charismatic theology in the modern Christian society. In a bid to establish a theology, there must be talks concerning God, but this should be handled in a critical manner.Advertising We will write a custom research paper sample on Charismatic Theology: Mission in the Spirit specifically for you for only $16.05 $11/page Learn More This translates that the apprehension of God generated becomes the formulae in tackling the dilemma the contemporary religious fraternity manifests to theology. Moreover, the theology that develops must also reflect the tradition of the religious fraternity from which it emanates. The theology must also mirror the manner in which God has been presented concerning the religious past1. Consequently, to be Charismatic entails how humanity ack nowledges the existence of the Holy Spirit. In practice, charisma entails receiving and presenting the works of the Holy Spirit to the contemporary society. In other words, Charismatic is a term referring to Christians who hold the notion that the doings of the Holy Spirit experienced in the early Church, such as miracles, tongue speaking, and healing, are also promises to the modern Christians. Therefore, to be genuinely charismatic, a doctrine should assume its meaning from the basis of the existence of the Holy Spirit as transcribed in the scriptures. Thus, a charismatic theology needs to consider the experience of the existence of the Holy Spirit as manifested in the Holy Scriptures2. It is only through the working of the Holy Spirit that a charismatic doctrine is established. Contrary to this claims, theology is seen to bring a misunderstanding about God and may fail to influence the believers. This paper seeks to show that the doctrine often spread within the Charismatic movem ent regarding self-imparted uniqueness, is widely uninformed and unbiblical. Since the movement accredits itself as sent by God to continue with his divine undertakings, it does not grant it a Christian experience. The purpose of this paper is to evaluate the various controversies surrounding the Charismatic doctrine as well evaluate diverse opinions from different quarters sharing or refuting the claims of the Charismatic movement. Much attention will focus on St. Paul’s perspective of spiritual gifts as it is written in 1 Corinthians 12- 4. Eventually, this paper will assess whether the Scriptures affirm exceptional Charismatic gifts to the modern Church. Background information The proliferation of the Charismatic renewal can be traced in the early 1960s3. The idea of filling with Holy Spirit diffused swiftly via the mainstream denominations. Many conventional churches were highly influenced by the Charismatic renewal, and later independent Charismatic churches started to e merge. Currently, most Charismatics have shifted from the mainline denominations to independent Charismatic churches.Advertising Looking for research paper on religion theology? Let's see if we can help you! Get your first paper with 15% OFF Learn More Following their break from the mainline denominations, these churches abandoned the doctrinal traditions that shaped them and then formulated others that guide the modern Charismatic. Following this freedom, the church started to transform in many ways. Apparently, charismatics of diverse faith and beliefs exist all over the world making it difficult to define the movement. Despite the fact that many people have joined the Charismatic movement, there are still problems that face this movement. Most Charismatic argues that their teachings supplement the traditional teachings. The distinctive contentions In the current decade, Charismatic Christians have experienced vast criticism by both Christians and non-believers. Jus t because the Charismatic movement or rather belief is widely spreading does not imply that its entire creed is justified. It is critical to consider the scriptures and examine the Church background in tackling the theological dilemma that is brought forth by the Charismatic values, practices, and beliefs4. It is highly disputable claiming of a second blessing or speaking in tongues as a proof of being filled with the Holy Spirit. Moreover, some of the gifts of grace and miracles are bizarre. In essence, the Holy Spirit dwells in the souls of all true believers, and this is not always evidenced by divine powers. The miracles manifested in the Bible were accrediting the scriptures. The â€Å"primary theological distinctiveness of the Charismatic movement includes speaking in tongues, the baptism in the Holy Spirit, the power of healing, and the importance of having a personal experience†5. These factors have contributed to the movement’s proliferation and popularity. Wh ile everyone cherishes growth and change, these two attributes cannot be employed as evidence for divine accredits. False religions and cults have also enjoyed massive growth and popularity. Regarding blessings and worldly possessions, Charismatics believe in a Christian life that is far much better than a non-Christian life. They claim that their faith leads them to riches, better health, and joyful lifestyle. However, it is clear that many Charismatics have good health, worldly possessions, and happiness6.Advertising We will write a custom research paper sample on Charismatic Theology: Mission in the Spirit specifically for you for only $16.05 $11/page Learn More The promise of good health and material possession has made new converts eager to abandon their ways to join the Charismatic theology for a better life. Unlike Charismatics, Evangelicals indicate that God is not fascinated by worldly things. For Evangelicals, the Christianity should not entai l worldly possessions but heavenly wealth granted freely upon salvation. Thus, this claim is misleading for anyone to believe that the Christian faith will unconditionally result in wealth, happiness, and good health. Thus, Christians should expect it but the absence of such blessings should not mean the absence of God. Both non-believers and Evangelicals have condemned such focus on worldly riches as diverting believers away from heavenly riches promised in the Scriptures. Evangelicals hold that Christ is the light all Christians need and promise for worldly prosperity manifests serious theological error7. Common viewpoints held by Charismatics Undoubtedly, Charismatic Christians demonstrate a high knowledge of the Scriptures but they often fail to abide by its content. In most instances, Charismatic Christians rely on what they believe rather than what is written in the scriptures. During the apostolic times, those who joined the faith in Christ went through water baptism. However , they also expected to go through a second step involving baptism with Spirit. The baptism in the Holy Spirit was highly valued as it was evidenced by characteristics of the Spirit particularly tongue speaking. The many gifts of the Holy Spirit transcribed in the Bible are also promises of the modern Church. Charismatics believe there are steps followed for one to attain baptism in the spirit. First, full commitment to Jesus Christ’s will, continuous prayer for the gift, waiting for the gift patiently and by faith, glorifying God for the gift, and freeing the Spirit by glorifying God in an unknown tongue. According to 1 Corinthians, as a Christian praise God in tongues, his/her mind rests as the spirit engages in prayer8. Despite the view that the Christian may not comprehend with the mind the utterances one says; there is a clear communication with the Lord. Charismatics also believe that speaking in tongues is an authority that Christ bestows upon the Christians to express and exalt the Lord in a new language. Thus, this gift should be respected and encouraged in the church. Charismatics also view that speaking in tongues does not divide the Christian family since division is only brought by the sinfulness nature of man9.Advertising Looking for research paper on religion theology? Let's see if we can help you! Get your first paper with 15% OFF Learn More Charismatics claim that the gift of healing is evidence that God exists, and there is the unquestioned truth about His word. Charismatics go further to show that the gift of miraculous healing is still availed to the modern Christian Church as it were in the first Church. However, since there is no ready reception in modern Church because of the influence of Western beliefs, Christians may not appreciate the divine intervention and the God’s healing. Tongue speaking Tongue speaking is a common practice to all Charismatics as well as Pentecostals. However, despite this being a common practice, there are variations in how these two denominations understand and define tongue speaking. Charismatics often believe in three varying applications of tongues. First, a massive number of Charismatics claim that speaking in tongues is the baseline proof of acquiring the baptism in the Holy Spirit. Charismatics believe that what transpired during the historical events as manifested in the teachings of Acts as extending to the contemporary Church. Second, â€Å"tongue speaking should be utilized in public worship for the elevation of the body†10. However, this tongue speaking must be meaningful and translatable to enhance clarity to all people. The comprehension that anyone experiences the baptism of the Holy Spirit should proof it by speaking in tongues is misleading since it blatantly contravenes the Bible. A third â€Å"use of tongues is meant for personal edification†11. In this case, tongue speaking is perceived as a personal connection language to God. These claims manifest a poor understanding of the Holy Scriptures. This assertion contributes to dividing the Christian family because not all Christians can speak in tongues yet they abide by the true word of God. Tongues are confirmed in various scriptures to be real languages rather than what Charismatics argue is special undefined personal prayer language. In most cases, it is agreeable that tong ues are meaningless to the listeners merely because they are presented in a foreign language. Thus, tongues should be translatable to bring meaning to the listeners. According to 1 Corinthians, 14:12-13, Paul emphasizes the need to interpret tongues12. In this passage, Paul claims that anyone who uses tongues edifies himself. The Charismatics misinterprets this passage since Paul is defining a person who uses tongues in public worship without an interpreter. However, tongue speaking in a Church without an interpreter does not benefit anyone and results to self-edification. Charismatics should ensure that what speaking in tongues is not viewed as a primary tool that every Christian must possess. Undoubtedly, it is essential to view tongue speaking as a foreign dialect but not meaningless utterances13. It is fundamental since it provides an objective criterion to establish if contemporary tongue speaking is valid or constructed utterances. Due to these contentions, many observers have called into question the authenticity of the Charismatic theology as a representative of the divine work of God. If contemporary tongues differ from the Biblical tongues, then it means that the Charismatic movement has abandoned true Biblical teachings. Unless, Charismatics can translate tongues, then tongues will have no impact in edifying the Church. Baptism of the Holy Spirit Spirit baptism is one of the cornerstone ratification of the Charismatic theology. Charismatics refer the Spirit baptism as an experience that one acquires following conversion. As evidenced in the book of Acts 11: 13-18, God is said to have poured out His Holy Spirit on the Gentiles, who had come to Him14. As shown in this passage, true believers in the early Church always acquired the baptism of the Holy Spirit free, but not as a reward gained, based on one’s doing. Contrary, Charismatics hold that Christians have to devote themselves in the course of seeking the Holy Spirit. Looking keenly at the events that transpired before the day of Pentecost, Jesus promised His disciples the Holy Spirit would descend to dwell in them. There were no requirements needed of the disciples before the Holy Spirit would pour on them. Jesus did not require them to pray or work hard for the gift of the Holy Spirit. There is no evidence in the Scriptures that some of the followers of Christ were declined the spirit due to inadequate preparation. The contemporary Christian Church should expect any gift from God, different or similar to those provided by the apostolic Church. However, with the massive spread of false prophets, it is critical for Christians to seek guidance from the Scriptures to know the true prophets guided by God. Charismatics admit that many members of the movement are taught the process of speaking in tongues, and others acquire the gift through prayer. During the apostolic times, tongue speaking was not learned or earned but God gave the gifts freely. However, training people to speak in tongues misleads the Christian community to believe of extraordinary need for having such gifts. The Holy Spirit shows Himself to the humanity through gifts with which He bestows the Christians. As mentioned in 1 Corinthian, 12: 8-10, such gifts include several tongues as well as the ability to interpret them15. These gifts are not meant for a particular group of believers, but rather to Christians who are given different gifts. The spiritual â€Å"gifts endowed by Spirit to every believer are meant to benefit the whole Church because Spiritual gifts are granted for the common good†16. Prophecy The question whether God is still communicating with the modern Church through direct revelation is debatable. The Holy Scriptures in the book of Acts 2, 10 and 19 interprets the gifts of prophesy, healing or raising the dead as historical events that happened in apostolic times. Charismatics have caused the controversy as to whether these gifts are provided by God to His p eople in the modern society. Charismatics still hold that believers â€Å"still experience direct revelation from God†17. Most Charismatics refute the claim that contemporary prophecies should reflect the Scripture. Consequently, Charismatics underrate the New Testament prophecy as a lesser revelation. In a bid to solve this controversy, it is essential to understand what prophecy is. True prophecy manifests the words of God passed to humanity via a prophet. Thus, a real prophet must speak the correct doctrine in the name of the real God. Additionally, all that is prophesied must happen with time. If a person proclaimed as a prophet and never makes a genuine prophecy, then there is no point to believe that person has a gift of prophecy. The Old Testament prophets manifested the qualities of real prophets because what they said happened. The teachings of Luke â€Å"present the story of the gifts of the Spirit as historical events and no attestation that such gifts are also pl edged to the future generations†18. However, the Church should expect that the Holy Spirit would provide it with the blessings that are required to develop the Church over years. Besides, God has other reservations for His people rather than those He gave the early Church. The contemporary Church must refrain from the assumption that because the Holy Spirit granted Daniel, the authority over Lions, the modern church should also expect God to provide such powers. Similarly, the modern Church should not argue that since the early Church had Christians with the gift of tongues, thus the modern Church must be endowed with matching gifts. When it comes to physical healing of the body, God wants Christians to focus on earthly ways that God has offered to for healing of the physically challenged. In this case, Christians are taught that they are yet in the existence of glory where pain and suffering will cease. Furthermore, Christians should never expect to undermine the control of G od, through prophecy or prayer. The Charismatics should refrain from thinking that they have the power to avoid suffering because they still live in a realm where sin and suffering are prevalent. Conclusion Even in the early Church, not all believers were granted with the gifts of prophecy or tongue speaking. Thus, the modern Christian Church must be cautious not to impart excessive concerns on such gifts. For instance, when tongue speaking is viewed as the key feature it results into a perception that undermines other benefits of the Holy Spirit. Through the Holy Spirit, the Christian fraternity is united to fellowship together in the glorification of God. Thus, it is lamentable that the Charismatics differentiate between those Christians baptized with the Spirit and other Christians. This divisive inclination fosters false belief that the former include a spiritually advanced cadre of Christians. The ultimate approach to determining a Spiritual gift should entail seeking whether i t builds the Church and abides by the written word of God. Christians should assess the impact that speaking in tongue has in building the Church. At times emphasizing on speaking in tongues might have negative effects to unbelievers for it might cause them think they are troubled. In many cases, these Spiritual gifts have been misused but these should not be used to discredit that such gifts exist. God has the power to bless the people with gifts that build the Church to future generations. Since they are no compelling Biblical evidence to discredit the existence of these gifts, it is upon the Christians to seek guidance from the Bible to understand genuine gifts. In a bid to reduce the confusion pertaining Charismatic theology, it is essential for Christians to learn from the Scripture and let it guide them in every matter. Bibliography Middlemiss, David. Interpreting Charismatic Experience. London: SCM Press, 1996. Mühlen, Heribert. A Charismatic Theology. London: Burns Oate s, 1978. Peppiatt, Lucy. â€Å"New Directions in Spirit Christology: A Foundation for a Charismatic Theology.† Journal of Theology 117, no. 1 (2014): 3-10. Pinnock, Clark. â€Å"The Work of the Spirit in the Interpretation of Holy Scripture from the Perspective of a Charismatic Biblical Theologian.† Journal of Pentecostal Theology 18, no. 2 (2009): 157-171. Poloma, Margaret. â€Å"Practical Theology: Charismatic and Empirical Perspectives.† Pneuma Journal 29, no. 2 (2007): 335-336. Quash, Ben. Found Theology: History, Imagination, and the Holy Spirit. Oxford: Bloomsbury, 2014. Spawn, Kevin. â€Å"Knowing the Holy Spirit through the Old Testament.† Pneuma Journal 30, no. 1 (2008): 174-175. Stronstad, Roger. The Charismatic Theology of St. Luke. Grand Rapids, MI: Baker Academic, 2012. Thomas, John. â€Å"The Charismatic Structure of Acts.† Journal of Pentecostal Theology 13, no. 1 (2004): 19-30. Williams, Rodman. Renewal Theology. Grand Rapids: Acade mie Books, 1988. Footnotes 1Heribert Mühlen, A Charismatic Theology (London: Burns Oates, 1978), 24-25. 2Lucy Peppiatt, â€Å"New Directions in Spirit Christology: A Foundation for A Charismatic Theology,† Theology 117, no. 1 (2014): 7. 3David Middlemiss, Interpreting Charismatic Experience (London: SCM Press, 1996), 41-42. 4Ben Quash, Found Theology: History, Imagination and the Holy Spirit, (Oxford: Bloomsbury, 2014) 76. 5Kevin Spawn, â€Å"Knowing the Holy Spirit through the Old Testament,† Pneuma Journal 30, no. 1 (2008): 174. 6Clark Pinnock, â€Å"The Work of the Spirit in the Interpretation of Holy Scripture from the Perspective of a Charismatic Biblical Theologian,† Journal of Pentecostal Theology 18, no. 2 (2009): 159. 7Margaret Poloma, â€Å"Practical Theology: Charismatic and Empirical Perspectives,† Pneuma 29, no. 2 (2007): 335. 8Poloma, Practical Theology, 336. 9Roger Stronstad, The Charismatic Theology Of St. Luke (Grand Rapids, MI: Bake r Academic, 2012), 65-68. 10Ibid, 71. 11Ibid, 71. 12Rodman Williams, Renewal Theology (Grand Rapids, Mich: Academie Books, 1988), 15-17. 13John Thomas, â€Å"The Charismatic Structure of Acts,† Journal of Pentecostal Theology 13, no. 1 (2004): 19-30. 14Ibid, 19-30. 15Stronstad, The Charismatic Theology, 19-20. 16Ibid, 72. 17Ibid, 78. 18Quash, Found Theology, 93. This research paper on Charismatic Theology: Mission in the Spirit was written and submitted by user Deon N. to help you with your own studies. You are free to use it for research and reference purposes in order to write your own paper; however, you must cite it accordingly. You can donate your paper here.

Free Essays on Postomodernism

Postmodernism. The term postmodernism is used in a variety of ways. On one hand, it has a common language usage, which is so broad and imprecise as to be effectively meaningless. On the other hand has also a rigorous usage which itself seems to have two variants: one as a term used to describe perceived conditions of the contrary world, the other, a term denoting an epistemological critique of modernism. In relation to strategy, the term postmodernism is a useful illustrative device used to suggest that it is a management and/or the world, which has changed, but what has really changed is our understanding of them. The locus of its ideas has been Europe, and of its development, application, and polemic has been the USA, and beyond that international. Virtually all the hundred-or-more contributors are American academics. For me, postmodernism is infuriatingly multi-dimensional but uniquely represents the paradoxes and reflexivities of modern living, bringing together a range of exciting disciplines to explain and explore experience, meaning and truth. The influence of postmodernism on management According to Norman Jackson and Pipa Carter, the influence of postmodernism on management is the emergence of three distinct conceptualisations of the â€Å"fact†. They have in common only their rejection – intentional or otherwise- of the modernist conceptualisation of formally logical truth, of the transcendent fact, and the consequent abandonment of a unitary management knowledge rooted in science. In this they offer, on the one hand, a resolution of the embarrassing paradoxes, which have inhibited management thinking in its modernist way, and, on the other, a plurality of approaches to post-modern management Features of post-modern way of living The modern and post-modern can be defined through contrasting sets of antinomies (Featherstone, 1988). The post-modern appears to represent a break with the modern, which is defined as being... Free Essays on Postomodernism Free Essays on Postomodernism Postmodernism. The term postmodernism is used in a variety of ways. On one hand, it has a common language usage, which is so broad and imprecise as to be effectively meaningless. On the other hand has also a rigorous usage which itself seems to have two variants: one as a term used to describe perceived conditions of the contrary world, the other, a term denoting an epistemological critique of modernism. In relation to strategy, the term postmodernism is a useful illustrative device used to suggest that it is a management and/or the world, which has changed, but what has really changed is our understanding of them. The locus of its ideas has been Europe, and of its development, application, and polemic has been the USA, and beyond that international. Virtually all the hundred-or-more contributors are American academics. For me, postmodernism is infuriatingly multi-dimensional but uniquely represents the paradoxes and reflexivities of modern living, bringing together a range of exciting disciplines to explain and explore experience, meaning and truth. The influence of postmodernism on management According to Norman Jackson and Pipa Carter, the influence of postmodernism on management is the emergence of three distinct conceptualisations of the â€Å"fact†. They have in common only their rejection – intentional or otherwise- of the modernist conceptualisation of formally logical truth, of the transcendent fact, and the consequent abandonment of a unitary management knowledge rooted in science. In this they offer, on the one hand, a resolution of the embarrassing paradoxes, which have inhibited management thinking in its modernist way, and, on the other, a plurality of approaches to post-modern management Features of post-modern way of living The modern and post-modern can be defined through contrasting sets of antinomies (Featherstone, 1988). The post-modern appears to represent a break with the modern, which is defined as being...

The major causes and consequences of ruralurban migration in the Essay

The major causes and consequences of ruralurban migration in the developing countries - Essay Example The migration culture in India was initially confined to the lean season for agriculture at many parts of the region till the end of summer. People used to flee to nearby towns and cities for working as daily wage workers at construction sites and other jobs to meet their expenses. They used to return to native villages when the rains arrives and used to spend their time in cultivation. The consistent unstable rains, the famines, the drought have unsettled the farmers resulting in migration to the urban areas. The growing IT and ITES boom with strong real estate drive created opportunities with sufficient work year round with satisfactory income made the rural folks to stay away from their lands. The ever growing cities expanses have swallowed nearby villages which made some wealthier and left with some no land to cultivate who ultimately migrated to cities in search of survival. The low literacy rates in the rural population: The rural population is mostly illiterate due to lack of awareness to educate themselves and concentrating more the physical work they need to perceive in the fields to cultivate. The villages are remotely located at times isolating them from the rest of the world and he developments. The villages had primary schools and at times high schools in major villages. The facilities provided at the schools as not encouraging. Child labour being cheaper than the elder wages and the poverty of the families force every one to work The families send their children for daily labour like every other family member to earn the daily expense when they migrate to towns and cities which does allows the children to perceive their education. The low and specific skill oriented farmers: The farmers in most of the developed countries cultivate with the primitive methods. The cultivation methods were not effective to yield good returns. The crops need more water, and in turn for more water they need electricity to pump ground water. The electricity is more scarce and expensive for already lean farmers. The farmers have only specific skills like cultivation, cattle raring which were said to be unskilled jobs and does not yield at timely regular intervals. The works at urban and metros yield good daily income and the amount of earning will depend on the way he learns the particular job as he gains expertise. The facilities demand-supply gap in urban areas: The huge migrations were not to the two or three tier cities but to the metro which are already crowded. The ever growing demand for basic amenities does not provide a chance for a brief and refined plan but forces for a temporary makeshift which in turn leads to a non uniform town or city planning. The below par basic amenities like water, electricity and housing: The urban authorities are pressurized by the ever growing demand that might hinder the authorities to provide the requisite facilities. Reference: Impact of the rural urban migration on the sustainability of the cities, 7 May, 2004, available at http://www.wscsd.org/ejournal/article.php3id_article=109 Making India world skill capital, Education must cater to the need of the industry, 30October,2004, available at

International Law Dissertation Example | Topics and Well Written Essays - 1250 words

International Law - Dissertation Example But two aspects are fundamental to all political systems. One is that power--the ability to influence behavior--is the main means by which the political system directs behavior and allocates resources. The other is that law is always one form in which political decisions are formed and perpetuated. Law translates political decisions into binding instructions to the society's members about how to behave. This dependent relationship of law to politics has important consequences. Another thing that will be discussed in the paper will be Law and Politics. A brief introduction of how this portion will be discussed in the paper is as follows: One consequence is that the inadequacy of the contemporary political system to maintain social order reliably is necessarily reflected in the law. The insistence of states to be sovereign, i.e., to be their own ultimate authority in determining their behavior, disables the law to perform its ordering function most efficaciously. The immediate cause of this weakness is the diffused, horizontal distribution of power among states. The institutions that maintain an efficient legal system in national political systems are lacking. There is no central government, no formal legislature, no executive, and no fully developed judiciary, because sovereign states aim at performing all these functions for themselves and, if possible, for the entire society. Another consequence is that international laws, like all laws, mostly represent a prevailing power constellation in the society.

Cultural Beliefs and Stigma Essay Example | Topics and Well Written Essays - 750 words

Cultural Beliefs and Stigma - Essay Example Investigation of the impact of cultural beliefs and stigma on the treatment journey of infectious patients needs include the burden from the stigma of various health problems and cultural beliefs. In the course of examination of the stigma and its effects on the patient comparisons must be made. These comparisons include the magnitude and character of stigma for different conditions and in different social and cultural settings; identifying distinctive features of stigma that may guide intervention programs; and evaluating changes in the magnitude and character of stigma over time and in response to interventions and social changes. (leininger M (1991) Such research benefits by examining stigma from various vantage points, considering the experience of stigma among persons with a designated health problem, laypersons in the community, and health care providers or other designated subgroups of the community (eg, teachers and policymakers) that have a substantial impact on health. Research on stigma should also consider questions of social policy as they relate to human rights, access to health care, and social services for particular groups. Our review of health research issues and studies considers the role of stigma in specific mental health problems and tropical diseases, mainly in low- and middle-income countries. We also discuss the limitations of this research and the need for complementary quantitative, qualitative, problem-specific, and culture-specific approaches to study of stigma. (Weiss 2001-p 5) The reason hat health research is concerned with stigma is that stigma is an important consideration for health policy and clinical practice for several reasons. It contributes to the suffering from illness in various ways, and it may delay appropriate help-seeking or terminate treatment for treatable health problems. For diseases and disorders that are highly stigmatized, the impact of the meaning of the disease may be as great or a greater source of suffering than symptoms of a disease. An early presentations of paucibacillary leprosy as a painless depigmented or anaesthetic patch is an example. Hearing the diagnosis is more troubling than symptoms of the disease. Social science studies of stigma regard it fundamentally as a problem arising from social interactions. Goffman and other researchers have also recognized self-perceived stigma, which may also be troubling and responsible for diminished self-esteem whether or not it arises from an actual interaction, and whether or not t his perceived stigma accurately reflects the critical views of others. Stigma impairs the quality of life through concerns about disclosure, and it affects work, education, marriage, and family life. Although its impact is likely to be overlooked in the calculation of Disability-adjusted life-years (DALYs), stigma contributes to what WHO's Nations for Mental health Program calls the hidden burden of mental illness. In addition to the suffering it brings, research also shows that stigma and labeling may affect the

Performance Measurement Of Financial And Non Financial Results Accounting Essay

Performance Measurement Of Financial And Non Financial Results Accounting Essay Every organisation strive for good performance. Performance improvement considers organisational change where management of the organisation puts in place some projects to help boost the current level of performance. In this respect the programmes may completely change the organisation behaviour and conducts to allow the changes to take effect. Management aims to increase the organisational effectiveness and efficiency in delivering its products and services. As the matter of fact performance requires performance measures to evaluate the financial and non financial results. Thereafter performance gaps and future improvement actions are planned considering ethical aspects. Most organisations use performance indicators which serve as powerful approach to monitor and improve performance. Organisations use different methods and techniques they have developed to process changes for improvement purposes. Most of people measure companys performance by looking at amount of money the company has just made. They consider profit, ROI, revenues to be the measure for performance. The main problem of considering only financial aspects of the business is that these measures report the past actions that the company may have no immediate control. Taking an example of customer aspects, they are not directly covered under financial aspects. Focusing only on financial aspects may in the long run jeopardise the companys relationship with the customers and may look for their needs with the competitor company. In view of the above a more comprehensive and clear approach is needed that put equal weight and emphasis to both financial and non financial aspects. An approach that not only considers lagging indicators but also looks forward and consider leading indicators. This prompted the researcher to consider using the Balanced scorecard framework in evaluating the performance of the Local Authorities Pensions Fund (LAPF) and to recommend actions to improve the current level of performance. The research topic explains by itself, and aims to find out the performance improvements that could be achieved when LAPF opts to implement the BSC approach. Thus the topic covers two aspects; performance improvement and the Balanced Scorecard. Balanced Scorecard ( BSC) Approach As it is mostly known, the BSC strikes the balance between the financial and non financial measures of performance. In short BSC is a framework used for evaluating business performance of a company. Kaplan and Norton consider BSC as Organisational performance management tool. As will be reviewed in Chapter two,( section 2.3) BSC involves defining company mission, strategy and measures. These should be clear and agreed upon by the interested stakeholders. After the BSC is set management should try to understand the factors that cause change and fluctuations of the BSC. These factors are very important as will lead the organisation to fully understand where and when to spend to cover the performance gaps. The following diagram ( figure 1.1) shows a simple balanced scorecard template.( adopted from Kaplan and Norton,1992.) Financial perspective Internal process perspective Vision strategy Customer perspective Learning growth perspective Figure 1.1 Balanced scorecard template For each of the four perspectives, strategic goals that link with the vision and strategy are established together with the relevant measures. For a beginner like LAPF this simple structure is recommended to maximise the chances for successful implementation. As the BSC is a continuous approach, management may later wish to adjust the objectives and measures to reflect the current operating and economic conditions. Performance improvement cycle Performance improvement is a continuous process. It can be thought of as a cycle. Consider the following diagram ( figure 2) with the explanations below. Figure 1. 2 Performance Improvement Cycle Explanations Plan: The organisation needs to know what should be accomplished and plans strategically. Plans should be integrated and aligned with the corporate strategy. Management also should set the objectives and goals to achieve the corporate strategy. The process also involves defining responsibilities and communication means, identifying talented personnel to lead the execution process. Execute: The process involves putting the plans into actions. This entails the execution of the planned activities to achieve the budgeted profit and loss account, forecasted balance sheet and cash flow statement. Normally the plans are for a short time period covering one financial year. In most cases it is done in operational level. In this study the performance will be evaluated considering 2009/10 plan budget. Check ( measure): The organisation then measures the performance using the indicators already established. This involves comparing the realised performance with the budgeted plans. Without measuring the performance ,the organisation does not know whether changes need be applied to reach the budgeted goals or to change the goals for the year. Act: At this stage ,the organisation should think and decide on new ways that may result in improvement. Here changes are important but should be carefully considered if when implemented the results will be improvements. Brain storming takes place at this stage. It is also from this stage where management should find out the root causes of bad or unsatisfactory performance and identifies hurdles to success. As will be explained in chapter three (section 2.5) implementing changes pose a challenge to many managers. It is therefore recommended that a clear and systematic process be adopted to make changes successful. Performance improvement needs changes. In another words, this is the improvement methodology stage where management can think of improvement approaches such as BSC, Six Sigma, TQM, etc. 1.2 SPONSOR COMPANY PROFILE- The Local Authorities Pensions Fund( LAPF) The Local Authorities Pensions Fund (LAPF) is a social security institution established under the LAPF Act No 9 of 2006. This Act repealed the Local Authorities Provident Act No.6 of 2000.The difference is that the former Act no 6 of 2000 was meant only for Defined Contribution Plan while the existing Act No.9 of 2006 is for Defined Benefit Plan. LAPF as one of the six social security institutions in Tanzania was established with the objective of providing social security cover to the employees of the local government authorities, agencies and Institution owned by Local Authorities. As per the Tanzanian government regulation each of these six schemes was established by different legislation and covers a defined category of people or sector. LAPF has more than 70,000 members each contributing (on a monthly basis) a total of 20% of members basic salary (an employees basic salary), of which the employers share is 15% and 5% is contributed by the employee (member). Apart from the Head Of fice (in Dodoma region) the Institution has five Zone Offices throughout the country covering 4 to 5 regions for each Zone. Vision, To become one of the best provider of social security cover in Tanzania (LAPF Act) Mission Statement, To provide social security benefits with related services to its members. (LAPF Act). In summary, the following are the main functions of the Fund: Pay benefits to insured person Improve benefits payable under the Act Register persons required by the law to contribute to the Fund Safeguard members contributions and other Funds resources Invest contributions in less risk and high returns yielding investments 1.3 PROBLEM DESCRIPTION For years now LAPF uses financial measures in evaluating the success of the Fund. As the competition in social security markets becomes an intense and rapid development in business, reliance on financial measures becomes questionable. This results to some of the financial measures to be ineffective and inefficient in evaluating the Funds performance from its operations, e.g. how to measure customer satisfaction. Through the performance measurement system any Organisation gets a comprehensive view of how it is performing. LAPF as a performance-driven and achievement-oriented in a competitive social security industry, needs to maintain an efficient performance measurement system. The system is used to track the changes in overall performance. Thus, the researcher aims to propose the use of BSC framework as the approach that will be applied in evaluating and improving the performance of the Fund. LAPF may wish to adopt the BSC system in measuring its performance to solve the problem of ineffective measures of performance recently adopted. Thus at this initial stage the aim of the study is not to implement the BSC approach. Balanced Scorecard involves both financial and non financial performance measures. In 1990, BSC was established by Robert Kaplan and David Norton to complement financial measures.The technique has recently become famous and widely adopted by some Organisations due to the benefits derived from its implementation. The application of only financial measures to evaluate performance may not give a real picture on how the Organisation performs. This prompted these Organisations to switch their strategies in assessing their performance applying critical measures (both financial and non financial) in each of the four BSC perspectives. Thus balance scorecard helps management to understand a comprehensive picture of the business operations grouped into these four categories i.e. Financial, Customers, learning and growth, and internal process. LAPF as the first time user of BSC will have to choose relevant performance measures for each of the above categories keeping in mind the nature of its business. The adoption of BSC as a set of measures will help management in formulating strategy to achieve the Funds objectives. It is believed that BSC will bring about management revolution and will provide real insight in the operations of the Fund as both financial and non financial performance measures will be employed in evaluating the success of its operations. 1.4 RESEARCH OBJECTIVES The main objective of the research is to find ways of improving LAPF performance. To achieve this, the researcher will adopt the Balanced Scorecard (BSC) framework to evaluate the performance of the Local Authorities Pensions Fund (LAPF) .The performance will be evaluated in each of the four BSC perspective i.e. financial, customers (members), internal process, and Learning growth. In this respect the researcher will compare the expected planned performance (as per the LAPF policy, budget etc) with the current performance as perceived by employees and management (resulted from questionnaires and interviews). It should be noted that the researcher DOES NOT aim or plan for BSC implementation. Other objectives are as outlined below: To assess the level of BSC understanding among employees To build positive image of BSC in the eyes of LAPF management and staff To persuade the Organisation to adopt the BSC approach To propose a BSC structure relevant to the LAPF needs, objectives and operations To find out whether the Fund has another alternative method for improving the performance besides using BSC approach Lay down foundations for further research on improving performance measurement system. 1.5 RESEARCH QUESTIONS 1.5.1 Main Research Question What can be the performance improvement by implementation of the Balanced Scorecard(BSC)?The case of Local Authorities Pensions Fund in Tanzania (LAPF) 1.5.2 Theoretical research questions What is Performance Measurement? How can it be improved? What is Balanced Scorecard? How widely is Balanced Scorecard used? What are the benefits of using Balanced Scorecard? What are the problems and /or challenges in implementing the BSC? How to reduce the chances of BSC failure? What are the metrics for measuring performance? Are there any other tools for improving performance measurement besides BSC? How do they differ from Balances Scorecard? 1.5.3 Empirical research questions How does LAPF measure its performance? What does LAPF understand about the BSC? Is the approach known? To what extent? Is the proposed BSC relevant to LAPF operating environment? Will the LAPF management accept changes? How does employees and management evaluate the current performance of the Fund? (As per the proposed BSC framework) What are the benefits expected to LAPF from the proposed approach? What are the challenges in the process of improving the Funds performance? What are the efforts being adopted to improve the Funds performance? Any other alternative besides the proposed approach? 1.6 PROPOSED BALANCED SCORECARD FOR LAPF Table 1 below is a proposed BSC framework for LAPF as designed by the researcher. This framework stands as the main research area as it was used to evaluate the Funds performance. The questionnaire and interview questions were based on this framework to find out what should be the level of performance ( as planned by management), what is the current level ,and what should be done to improve the current level of performance. It is expected that the contents of the BSC ( goals and measures) may be adjusted after accommodating comments from the LAPF management and staff .This research does not cover implementation of the BSC, the decision on whether to fully implement the BSC approach lies with the LAPF management ,where the Fund will have to study and plan for the implementation process. THE LOCAL AUTHORITIES PENSIONS FUND PROPOSED BALANCED SCORECARD VISION: To become the best and most preferred provider of social security in Tanzania 1 Financial Perspective Actions ( Critical Success factors) Measures Invest the contributions received in a highly and secure yield investment ( Accurate investment decision making) -Return on Investment (ROI) Survive -Increase in premium Growth -Percent increase in Cash Flows Profitability -Return on Assets Effective cost reduction -Percent reduction in cost Risk Mitigation -Percent reduction in risk occurrence -Percent of loss due to risk Budget accuracy -Percent error in forecasts 2 Members Perspective Actions ( Critical Success factors) Measures Increase membership base -Number of new members registered Members satisfaction -Frequency of members complaints -Members Survey rating -Complaints response time -Timeliness of service -Service accessibility Provide seminar and education to members -Number of seminars conducted -Market share Attract more members and retain members -Number of new members -Increase in premium -Retention rate Increase Benefits Packages -Number of new packages -Lead time (time taken to introduce new package) Marketing LAPF and its products and services -Market share 3 Internal process Perspective Actions ( Critical Success factors) Measures Process capabilities -Percent reduction in payment cycle time Provide benefit package on time -Claim processing time Service improvement -Number of customer problems reported over a period of time Quality -Percent reduction in rework -Industry quality rating Effective reporting/information system -Average time for circulation information -System availability Percent of late reports -Percent of errors in reports Maintain inter departmental team work -Number of days to communicate feedback -Information circulation time 4 Learning and Growth Perspective Actions ( Critical Success factors) Measures Training to employees -Training time per employee -Number of employees trained Employee satisfaction -Employee turnover rate -Chances for empowerment and promotions -Level of freedom of opinion and suggestions -Percent of employees suggestions and recommendations put in action -Percent of complains about salary and incentives -Response time to employees complaints Continuous innovations -New products /service Opportunity level to show creativity Team building and effectiveness -Percentage of empathy level -Percentage achievement of goals Table 1.1 LAPF proposed BSC 1.6 .1 Strategic Mapping Strategic map shows the cause-and-effect relationship. Applying the four BSC perspectives, we are able to draw a cause -and -effect logic flow to show the relationship between them. In simple words it depicts the link that exists between the perspectives. It therefore outlines what a company wants to accomplish (financially and to members) and how to accomplish it ( through effective and efficient internal processes ,supported by competent, motivated and creative employees). Figure 1.3 below shows an example of strategic map relevant to LAPF operations. Revenue (Contributions) Cash flowFinancial Operating Costs Contribution Arrears Members complaints Members satisfaction Members Claim reprocessing Payment cycle timeInternal process Employees suggestions Employees competenceLearning Employees moraleGrowth Figure 1.3 LAPF Strategic Map Explanations: If LAPF employees lack incentives to boost their morale to work, it negatively affects the time taken to process members claims. In turn this brings members complaints that cause delay in submitting contributions in time. The ultimate effect of it is insufficient cash to operate,invest and pay other beneficiaries. Incompetency employees make errors in processing the claims that necessitate reworking the claims. This increases the operating costs that reduce the cash flow status. High employees morale, shorter payment cycle time lead to members satisfaction. In turn increases contributions that boost the cash flow. Low morale, ignoring employees suggestions and incompetent employees all together result to employees dissatisfaction. This may in turn prolong the payment cycle time, which results to members dissatisfaction. Eventually this results to delay in contributions which at the end affect the Funds cash flow. Note: Figure 3 shows only some few measures as indicated in the balanced scorecard. More measures can be added and a link with a logic flow be established to show the cause and effect relationship between the BSC perspectives. 1.7 ETHICAL CONSIDERATIONS The research was conducted as per the LAPFs code of ethics. Participants were free, to control their own willingness to participate, contribute or even to withdrawal. Where confidentiality and anonymity was demanded the study adhered to this and make sure no harm, pain or discomfort is caused to any participant. Adherence of ethical issues in each stage of the research process from, data collection, analysis and reporting is my priority consideration. The Fund will be briefed of the research findings. 1.8 ROAD MAP This thesis comprises of five chapters. Chapter one: Consists of general introduction and the topic to be researched. It also contains brief explanations of the concepts found in the main research topic, i.e. Performance improvement and the balanced scorecard. Chapter two: Consists of all relevant literature concerning the balanced scorecard, performance improvement, and change management which is very important to consider before undertaking any programme to improve performance. I personally consider change management to be very critical and is influenced by several internal and external factors. From this chapter we will have an opportunity to understand stages that lead to successful changes. The common mistakes/errors done by the organisation when adopting changes ( which are the main causes of failure) as explained by John Kotter ,1996 are also found in this chapter. Moreover the chapter contains other performance management approaches beside the balanced scorecard and a review on how they relate or differ with the BSC. Chapter three: Comprises of methodological section. In short questionnaire and interview are the main sources of data collection for this research. In addition to this, it also includes sampling and respondents information. Chapter four: Includes the results and discussion thereof. It also includes analysis of data collected through questionnaire and interview. Chapter five: Explains the conclusions and recommendations based on the data collected. 1.9 LIMITATIONS This study has the following limitations; This research does not cover implementation of the BSC in LAPF. It is limited to the use of the proposed BSC framework to evaluate LAPF performance, where by the Funds objectives and their related measures are more specific. It is from the findings , conclusions and recommendations LAPF management may think and plan the implementation of this approach. The study is limited only to the Local Authorities Pensions Fund due to time and financial constraints. It does not cover any other firm in the social security industry in Tanzania, neither LAPF performance will be compared to preceding years performance The planned number of interviews to be conducted could not be reached as the targeted staff were out of the office for different reasons. In this regard the researcher decided to increase the number of questionnaires to be supplied from 30 to 40 in order to collect as many data as possible. The indicators and measurement tools in this study make use of secondary data in measuring performance. Secondary data may have inaccuracies. Inaccuracies in data could result in results which are unreliable and unsuitable for measuring performance and in achieving targets. Weights have not been placed on any particular dimension or goal area. LAPF priorities change with changing national Social Security needs and it may be necessary to accurately place additional weights on some dimensions to achieve the desired outcome.

Romeo And Juliet: Fate :: essays research papers

The only theme that tragedy reveals is that the noble and good must suffer. There is no lesson we can draw from tragedy that will help us avoid the fate of the protagonist. It is known that in Shakespeare’s tragedies the main characters die in the end. Romeo and Juliet being a tragedy, sets up a situation where we know that Romeo and Juliet are going to die in the end. There are many events that lead to their deaths. The Capulets and Montagues share the responsibility for the deaths of Romeo and Juliet because of each family’s stubborn refusal to end an enduring feud. If their feud could have been resolved the children of each family would not have shared this terrible fate. Friar Lawrence was also partially to blame through his actions in trying to help the couple. At the end of the story the Prince, is the only character who reminds everyone the reality of how Romeo and Juliet’s death occurred because of everyone’s faults. Romeo and Juliet didn’t even try to tell their parents, Lord and Lady Montague and Lord and Lady Capulet, about love between they shared for each other because they were afraid that their parents wouldn’t understand them. Perhaps the families would have understood, the problem is, we don’t know, because Capulet and Montague learned about their children’s love when they were already dead. If Romeo and Juliet were comfortable with telling their parents of their marriage then there would have been fewer complications regarding the marriage with Paris. If it wasn’t for the hostility between the two families then they wouldn’t have cost Romeo and Juliet their lives. The masque was the most important part of the story. Romeo was wearing a mask to hide his face. Since Juliet couldn’t see his face, it allowed Juliet to fall in love with him before she saw who it was. If Juliet had known Romeo was a Montague she would probably not have fallen in love with him. Juliet said: "My only love, sprung from my only hate! Too early seen unknown, and known too late!" (I-5) Juliet realizes that it was a mistake to fall in love with Romeo, because he is a Montague, but it is too late, because she is already in love. Friar Lawrence also had a big part in the story. All his good intentions, the play still ends in tragedy.

When Small Means Big: The Impact of Nanotechnology

A revolution in science and technology, which will significantly impact our daily lives, is looming in the horizon. The scientific community is now excited by changes that could be brought about by the multidisciplinary discipline of nanoscience and nanotechnology, which is comprehensively defined asâ€Å"[r]esearch and technology development at the atomic, molecular, or macromolecular levels, in the length of approximately 1–100 nm range, to provide a fundamental understanding of phenomena and materials at the nanoscale, and to create and use structures, devices, and systems that have novel properties and functions because of their small size. The novel and differentiating properties and functions are developed at a critical length scale of matter typically under 100 nm.Nanotechnology research and development includes integration of nanoscale structure into larger material components, systems, and architectures. Within these larger scale assemblies, the control and construct ion of their structures and component devices remain at the nanoscale†. (National Research Council 2002, cited in Dreher 2004).Although technically encompassing any device measuring at least 1,000 nanometers—a nanometer (from Greek ‘nano’, meaning dwarf) is one-billionth of a meter (The Royal Society & The Royal Academy of Engineering 2004)—much of the work being done presently focuses on materials smaller than 100 nm (Gupta et al 2003) since it is at this level that materials exhibit unique physical and chemical properties that can be harvested to convey improvements to engineered materials (i.e. enhanced magnetic properties, better electrical and optical activity, and superior structural integrity) (Thomas & Sayre 2005).Ralph Merkle, as cited by Gupta et al (2003), noted that atomic configuration, to an extent, determines physical and chemical characteristics of materials, using as examples carbon in diamond, or silica from sand. From this perspect ive, the manufacturing techniques we are using today appear crude since we are moving molecules by heaps and mounds, and, therefore, are manufacturing devices that could still be improved for accuracy and precision (Gupta et al 2003). Nanotechnology, according to Gupta et al, aims to explore and exploit the possibility of designing at the molecular and atomic levels, and producing a generation of novel products that boast of greater strength, lighter weight and better precision (2003).Technically nanotechnology is not something new. Ball (2003) notes that nanoscale devices have been, and are currently being, utilized by organisms in their daily functioning. He cites, for instance, the proteins that serve as motors to flagella of motile bacteria, as readers and interpreters of the genetic code, or as miniature solar panels in plants that gather sunlight for photosynthesis (Ball 2003). The possibility of harnessing this potential within the environment and put them to practical use ha s been floated in the scientific community as early as the 1940s, when von Neumann forwarded the idea of manufacturing systems or machines that are capable of self-replication, which could potentially lower production costs (Gupta et al 2003).Richard Feynman in 1959, in an address to the American Physical Society entitled ‘There Is Plenty of Room at the Bottom’, advanced the possibility that, similar to what we are doing at the macroscopic scale, we could maneuver atoms to where we want them to be, and produce materials that would solve the problem of manufacture and reproduction (Buxton et al 2003; Gupta P et al 2003). In 1986, K Eric Drexler provided a picture of nanotechnological use in the future in his book Engines of Creation, where humans are utilizing self-replicating nanoscale robots in daily life processes (Ball 2003).The move from the drawing board to actual application, however, has been very recent—as evidenced by the relatively few nanotechnology pr oducts—fuelled by theoretical and laboratory progress which showed that, indeed, systems can be built from molecules and atoms maneuvered at the microscopic scale (Gupta et al 2003). L’Oreal recently introduced in the market sun creams that contain nano-sized grains of titanium dioxide, which absorbs ultraviolet light, but without the ‘smeared chalk’ appearance of regular creams (Ball 2003). This same technology, according to Ball (2003) was taken a step further when it was found that titanium dioxide particles become reactive when exposed to ultraviolet light, leading to the development of self-cleaning tiles and glasses—titanium-coated tiles and glasses that use the sun’s energy to burn up dirt stuck to their surfaces. In the filed of medicine, nanotechnology is currently being utilized with state-of-the-art technology to combat genetic diseases (Dunkley 2004).In addition to these, researches are currently undergoing, exploring the various possible applications of nanotechnology in various fields. For instance, in the medical sciences, the development of nanorobots could aid in precise, and rapid, cellular repair and regeneration, delivery of drugs at the site where it is needed, destruction of cancerous cells, or unblocking of clogged blood vessels (Dunkley 2004). The capacity to detect disease through alterations in body chemistry or physiology is also a possibility through nanotubes or nanowires coated with detector molecules (Buxton et al 2003). Molecular imaging, according to Buxton et al (2003) will also provide us with a view of the human body beyond gross anatomic structures, since this would utilize molecules that would home to tissues affected by specific disease processes. Environmental problems we face today, such as air pollution or oil spills, could be remedied through nanorobots designed to clean these toxic elements from the air we breath or the water we drink (Dunkley 2004).The material sciences will also significantly benefit from nanotechnology, with the promise of development of stronger and lighter plastics, computers with faster processors and increased memory storage, ion storage for batteries (which will improve performance), quick-charging battery cars, and fuel cells for motor-driven devices that are environment-friendly and energy efficient (Gupta et al 2003). Perhaps a bit too far in the future, Dunkley even forwards the idea that it might be possible, with nanorobots moving atoms and molecules, for us to create common and everyday things from our own backyard, moving manufacturing to the domain of the household with a wheelbarrow and a shovel (2004).Because of the great promise held by nanotechnology, governments worldwide are investing in nanoresearch, to further refine our understanding of this small world. Global investment in nanotechnology has been estimated to be â‚ ¬5 billion, according to the Royal Society and the Royal Academy of Engineering (2004). The E uropean Union pledged to spend â‚ ¬1 billion (Ball 2003), whereas Japan allocated $800M in 2003 (The Royal Society & The Royal Academy of Engineering 2004). The United States is willing to spend nearly $3.7 billion for nanotechnology from 2005 to 2008, with nearly $500 million allocated for research funding (Dunkley 2004; The Royal Society & The Royal Academy of Engineering 2004; Thomas & Sayre 2005).The considerable change nanotechnology can bring, as well as the huge sums of money governments worldwide are currently spending to make this a reality, has sparked some questions from various sectors on the impact of nanotechnologies, not only to the scientific fields to which it will be applied, but to the society in general. In the biological sciences, for instance, the primary concern is the possible toxicity exposure—and chronic exposure, at that—to nanoparticles can bring about, since these materials have the capability of interacting with cells and cellular organ elles, and hence, alter body physiology (Ball 2003; The Royal Society & The Royal Academy of Engineering 2004).Dreher (2004), and Thomas and Sayre (2005) have recently reviewed the evidence on the health impact of nanotechnology exposure, and found that there is a paucity of evidence to encourage or preclude use of nanotechnologies in humans pending full investigations and detailed evidence supporting or debunking the same. Ball (2003) notes that, in the same way as new drugs or devices, nanotechnology must be viewed as a potential health hazard unless proven otherwise. Large scale production in the future would necessitate hazard-testing and human exposure assessment, to minimize risks (The Royal Society & The Royal Academy of Engineering 2004).The significant economic impact of nanotechnologies, according to experts, may not be felt in the short-term, although this must be viewed with caution, since it is entirely difficult to predict what impact a developing technology that has n ot yet realized its full potential will have (The Royal Society & The Royal Academy of Engineering 2004). The differing capacities of developed, developing and underdeveloped countries to participate in the nanotechnology race has also raised concerns that it might intensify the economic gap between these nations, leading to what is referred to as a ‘nanodivide’ (The Royal Society & The Royal Academy of Engineering 2004). Finally, patenting of nanotechnology—which is advantageous since it would, though economic incentive, encourage other individuals to contribute to scientific progress—may stifle creativity or innovation when a broad one is granted (The Royal Society & The Royal Academy of Engineering 2004).Another area of concern is military and defense capability. The development of new devices—pervasive sensors, improved clothing and armor, and enhanced information and communication exchange—could be viewed both as opportunities and threat s, depending on who uses them, and how they are used (The Royal Society & The Royal Academy of Engineering 2004). But more than this, the Royal Society (2004) cautions that the secrecy coupled with development of technologies for defense use might fuel public distrust, and heighten the understanding that nanotechnology is being developed primarily, if not entirely, for military ends.Ethical issues pervading the socio-cultural impact of nanotechnologies are also a concern. For instance, development of new nanodevices may cause a significant change in employment patterns, role perception, education patterns, and eventually family life (Dunkley 2004). The end result, still according to Dunkley (2004) would be a shift in our present definition of inequality, poverty, and class, and finally, the way we construe society in general.If what Dunkley predicted would come true (i.e. manufacturing at our own backyard), then the capacity to produce would be entirely dependent on having the neces sary resources for this production, which brings to fore the concern of concentration of the harvests of nanotechnology in the hands of a few. Although nanomanufacturing could present the solution to hunger and homelessness, the question remains whether it will alter our perception of the material world where we move (Dunkley 2004).The possibility of devices being used to store personal information, although enhancing personal security on the one hand, also raises the possibility of violation of civil liberties, especially when collection and distribution of the same is made without the consent of the person involved, or access to these information could be limited to the hands of the few who could develop and control personal information databases or systems (The Royal Society & The Royal Academy of Engineering 2004).Finally, the possibility of radical human enhancement, or the creation of humans in the future, through nanotechnology (in conjunction with biotechnology and informati on technology), though a remote possibility, still carries with it the burden of resolving whether these creations are really human, and whether they also possess souls like we do (Dunkley 2004). In the same vein, this new capability would radically change, if not totally abolish, our perception of religion and morality (The Royal Society & The Royal Academy of Engineering 2004). On a lesser plane, the possibility of nanotechnology extending human longevity to hundreds of years will definitely alter our view of aging and death (Dunkley 2004).What, then, lies in store for us in the future with nanotechnology? Actually, no one can tell, since nanotechnology is but a frontier—which, to Melbin is a pattern of sparse settlement in space or time—or what Dunkley (2004) describes as relatively ‘unsettled and a wilderness waiting to be discovered’. Until such time, therefore, that the full potential of nanotechnology has been realized, or at least understood throug h research, we may endlessly speculate about how nanotechnology will affect our daily lives and society in general, who will benefit from its, what and capabilities will it provide us. The concerns, however, raised in this paper are valid considerations of the impact the future application of nanotechnologies will have, and this necessitates caution and vigilance on the part of all stakeholders.ReferencesBall P, 2003 (23 Jun), ‘Nanotechnology Science's Next Frontier or Just a Load of Bull?’, New Statesman, vol. 132, no. 4643, pp. 30-31.Buxton DB, Lee SC, Wickline SA, Ferrari M & for the Working Group Members, 2003 (02 Dec), ‘Recommendations of the National Heart, Lung, and Blood Institute Nanotechnology Working Group’, Circulation, vol. 108, pp. 2737-2742.Dreher KL, 2004, ‘Health and environmental impact of nanotechnology: Toxicological assessment of manufactured nanoparticles’, Toxicological Sciences, vol. 77, pp. 3–5.Dunkley RWS, 2004, ‘Nanotechnology: Social Consequences and Future Implications’, Futures, vol. 36, no. 10, pp. 1129-1132.Gupta P, Malhotra R, Segal MA & Verhaeren MYFJ, 2003, ‘Recent trends in nanotechnology’, in R Gulati, A Paoni & M Sawhney (eds), Kellogg on Technology & Innovation, Wiley, Hoboken, NJ, pp. 261-283.The Royal Society & The Royal Academy of Engineering, 2004, Nanoscience and nanotechnologies: opportunities and uncertainties, The Royal Society & The Royal Academy of Engineering, London.Thomas K & Sayre P, 2005, ‘Research strategies for safety evaluation of nanomaterials, Part I: Evaluating the human health implications of exposure to nanoscale materials’, Toxicological Sciences, vol. 87, no. 2, pp. 316–321.

Afroamerican essays

Afroamerican essays The American people have a serious identity crisis. Its rare while in the country to hear someone say that they are American. People say that they are Irish, Scottish, German, Italian, African, English, West Indian, etc. Often people are a combination of these. For black Americans it becomes even more complicated. Many want to identify as African but others would never dream of such a thing because its so foreign to them. I was speaking to a man at a party I had at my apartment. He was telling me about how he plays African drums, traveling around to different towns and performing. He had even been to my part of Cape Cod, Wellfleet. I asked him if he was African and his reply was vague. He couldnt really say yes but he wasnt about to say no. I thought that maybe he was second generation and that his parents were born there so I asked if his parents were African. He said, well I cant really say no, you know what I mean. It had come up earlier that I was An Afro-Am major and after that point as far as he was concerned we had some kind of connection. I was glad that it never became my turn at 40 questions. I am BI-racial and people react to that differently than others. To some its a scar on my blackness being that Im also half-white. To some it aint no thing black is black even if your not 100%. Of course finding a person whose 100% of anything these days can be a challenge. In the states if you are a small part black then you are black. We have this system, thanks to the good old days of slavery where no matter how white you looked and no matter how much you resembled the masters children, you were still black enough to be a slave. In other parts of the world the tables are turned. If you are even a small percent white then thats what you are. The past thirty years have seen many changes in the lives of black people in America. With the c...

Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Essay Example Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: ensembl.org/index.html. 4. [26/08/10]; Available from: genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gmez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4

Satan's fall from Heaven Research Paper Example | Topics and Well Written Essays - 3000 words

Satan's fall from Heaven - Research Paper Example Main views/theories on Satan's fall from Heaven The exact time of Satan's fall from Heaven is still clouded and leads to a number of different views and theories on the same. Some of the views/theories are pointed out here. Satan’s fall: between Genesis 1:1 and 1:2 This view/theory is generally known as ‘gap theory’. The chief exponents of this theory believe that the wide time interval between Genesis 1:1 and 1:2 is enough to the Satan’s fall from heaven. Hodge (2011), states that â€Å"Gap theorists try to make the case that the Hebrew in Genesis 1:2 should be translated as â€Å"And the earth became without form, and void† and this is subsequent to Satan’s fall† (p.24). Besides, this theory can be connected to the theory of evolution and the extinction of dinosaurs. When the gap is that of millions of years, there exists high possibility for Satan’s fall from heaven within this time interval. In addition, this theory tries to connect Genesis 1:1 with scientific division of ages. For instance, Genesis 1:1can be evaluated scientifically as the time interval of creation of the whole world by the God. Moreover, Genesis 1:2 can be evaluated as the time interval in which the God judged the whole wor ld. In short, the ‘gap theory’ tries to explain that Satan’s fall from the heaven is in between Genesis 1:1and 1:2. Satan’s fall: between chapters 1 and 2 (Genesis)... Satan’s fall: between chapters 1 and 2 (Genesis) The people who believe in this view/theory do not accept the fact that the earth’s age consists of millions of years. When this view is connected to the God’s creation of the world within six days, the time interval for the creation is limited to an extent. For instance, when the God created the whole world within six days, the age of the earth will be limited to thousands of years. Russell (1987), states that â€Å"The Devil fall from grace because he envied God, wishing to be adored like his maker, and even more because he envied humanity† (p.81). The exponents of this view/theory argue that Satan was created by the God on the first day of creation. Those who believe in this view/theory are of the opinion that Satan’s fall is in between the chapters 1 and 2 (Genesis). To be specific, the Satan in the chapter 3 of genesis is portrayed as a fallen angel. So, there exists high possibility for Satanâ₠¬â„¢s fall between his creation (chapter 1) and portrayal as fallen (chapter 3). So, the exponents of this view/theory argue that Satan’s fall is in between the chapters 1 and 2 (Genesis). Satan’s fall: before chapter 1 (Genesis) This view/theory is based upon the belief that Satan’s fall is not between Genesis 1:1 and 1:2, and chapters 1 and 2 (Genesis), but before chapter 1 (Genesis). This view/theory suggests that Satan was banished from the heaven long before Adam and Eve’s creation. Troyer (2007), states that â€Å" Some people believe Lucifer was kicked out of heaven long before the Garden of Eden was made or before God created the heaven and the earth† (p.116). The main argument is that chapter 1 (Genesis) makes clear that